Hairpin_loop Hairpin_loop

Hairpin loop - Definition

Related Words: Aberration, Bend, Bias, Chevron, Crook, Crooked, Curve, Declination, Departure, Detour, Deviance, Deviation, Digression
Hairpin structure of RNA
Enlarge
Hairpin structure of RNA

A hairpin loop in RNA is a sequence of nucleotides where a long segment of RNA can base-pair with each other, but a segment within that sequence can not base pair, causing a hairpin loop.

An example of a 5' → 3' sequence of RNA which would lead to a hairpin loop structure is:

GCCGCGGGCCGAAAAAACCCCCCCGGCCCGCGGC

The above sequence is an example of dyad symmetry, where the bases downstream are complementary to the bases upstream and so they form base pairs. Hairpin loops are important in prokaryotic transcription termination. The hairpin loop forms during transcription and the structure causes the RNA polymerase to become dissociated from the DNA template strand. This process is known as rho-independent or intrinsic termination.

Copyright 2009 WordIQ.com - Privacy Policy  :: Terms of Use  :: Contact Us  :: About Us
This article is licensed under the GNU Free Documentation License. It uses material from the this Wikipedia article.